Rac and Cdc42 GTPases control hematopoietic stem
cell shape, adhesion, migration, and mobilization
F.-C. Yang*†‡, S. J. Atkinson‡§, Y. Gu*†, J. B. Borneo*†, A. W. Roberts*†¶, Y. Zhengi, J. Pennington§,
and D. A. Williams*†**
*Howard Hughes Medical Institute, †Section of Pediatric HematologyyOncology, Herman B Wells Center for Pediatric Research, Department of Pediatrics,
and §Section of Nephrology, Department of Medicine, Indiana University School of Medicine, Indianapolis, IN 46202; and iDepartment of Biochemistry,
University of Tennessee, Memphis, TN 38163
Edited by Richard O. Hynes, Massachusetts Institute of Technology, Cambridge, MA, and approved March 9, 2001 (received for review November 17, 2000)
Critical to homeostasis of blood cell production by hematopoietic
stemyprogenitor (HSCyP) cells is the regulation of HSCyP retention
within the bone marrow microenvironment and migration be-
tween the bone marrow and the blood. Key extracellular regula-
tory elements for this process have been defined (cell–cell adhe-
sion, growth factors, chemokines), but the mechanism by which
HSCyP cells reconcile multiple external signals has not been eluci-
dated. Rac and related small GTPases are candidates for this role
and were studied in HSCyP deficient in Rac2, a hematopoietic
cell-specific family member. Rac2 appears to be critical for HSCyP
adhesion both in vitro and in vivo, whereas a compensatory
increase in Cdc42 activation regulates HSCyP migration. This ge-
netic analysis provides physiological evidence of cross-talk be-
tween GTPase proteins and suggests that a balance of these two
GTPases controls HSCyP adhesion and mobilization in vivo.
Multipotential hematopoietic stem and progenitor (HSCyP)cells reside within the hematopoietic microenvironment
(HM) located in the bone medullary cavity in mammals (1).
Adhesion and localization of HSCyP in this HM have been
shown to play a critical role in the maintenance of stem cell
survival, proliferation, and function (2). With the use of a variety
of indirect methods, such as stimulation of the entry of HSCyP
into the blood from the marrow space (called mobilization) or
inhibition of homing into the bone marrow space, several
integrin adhesion molecules have been implicated in HSCyP
localization in the HM (3–6). Pharmacologically induced mobi-
lization and collection of mobilized HSCyP from the blood have
gained wide therapeutic applications in stem cell transplantation
protocols. Whether active cell movement (i.e., migration) or
change in adhesive interactions or both play a dominant role in
mobilization has not been clarified.
Rho-related small GTPases, including Rho, Rac, and Cdc42,
are known to regulate cell shape changes, movement and
adhesion in multiple mammalian cell types (reviewed in ref. 7).
Furthermore, Rho GTPases have been demonstrated to activate
a number of signal transduction pathways involved in cell cycle
progression, gene expression, cell survival, and Ras transforma-
tion (8, 9). Biochemical pathways controlling the adhesion,
migration, or mobilization of HSCyP cells have not been com-
pletely defined, and to date GTPases have not been implicated
in HSCyP function. However, a member of the Rac family, Rac2,
has recently been implicated in the migration of other, more
differentiated hematopoietic cells in mice (10, 11), and a mutant
of Rac2 has been implicated in a human phagocyte immunode-
ficiency (12, 13). We used mice deficient in Rac2 and retroviral-
mediated gene transfer to study the role of Cdc42 and Rac in
hematopoietic HSCyP cell adhesion and migration.
Materials and Methods
Hematopoietic Cell Purification. In all experiments, 6- to 10-week-
old age- and gender-matched 129SvyC57BL6 mice or 129Sv
inbred mice were used, and littermates were analyzed in parallel
wherever possible. Mature cell lineage antigen-negative (Lin2)
cells were enriched by immuno-magnetic negative selection
(MACS; Miltenyi Biotech, Auburn, CA), with the use of a
mixture of purified rat anti-mouse mAbs specific for the mature
cell lineage antigens CD45R (B220, Clone RA3–6B2), Gr-1
(Ly-6G, Clone RB6-8C5), CD4 (L3T4, Clone RM4-5), CD8a
(Ly-2, Clone 53-6.7), TER119 (TER119), and Mac-1 (CD11b,
Clone M1y70) (all purchased from PharMingen). The nonmag-
netic Lin2 fraction was collected, washed, and counted. The
cells were then incubated with rat anti-mouse CD32yCD16 to
avoid nonspecific antibody binding, after which they were
stained with fluoresceinated (FITC) rat anti-mouse CD117
(c-Kit) and phycoerythrin-conjugated rat anti-mouse Sca-1
(both from PharMingen). Negative control cells were stained
with phycoerythrin-conjugated IgG2a and FITC-conjugated
IgG2b. Based on these controls, Lin2c-Kit1Sca-11 cells were
isolated by sorting with a fluorescence-activated cell sorter
(FACStar Plus; Becton Dickinson) under sterile conditions. To
avoid contamination of different cell types, the bright population
was gated. The purity of Lin2c-Kit1Sca-11 cells thus obtained
was .90%. Reverse transcription–PCR was performed with the
use of primers and methods described (11).
Real-Time PCR Analysis. Expression of the receptor for G-CSF was
analyzed by real-time PCR (14), with the use of duplicate samples
pooled from seven animals. For G-CSF receptor expression, CAC-
CAGCTTCATCCTAAAGAGCTT (forward primer) and TTGC-
CACACAATCCGGG (reverse primer) were used. The TaqMan
probe was 6FAM-CTGACAGTCGGCGCGGCTCCT-TAMRA
(6FAM, 6-carboxyfluorescein; TAMRA, 6-carboxytetramethyl-
rhodamine). TaqMan rodent glyceraldehyde-3-phosphate dehydro-
genase control reagents were used as the control; all of these were
purchased from Applied Biosystems. For CXCR4 receptor expres-
sion, GGTGATCCTGGTCATGGGTT (forward primer) and CT-
GACAGGTGCAGCCGGTA (reverse primer) were used. The
TaqMan probe was 6FAM-TGTCCGTCATGCTCCTTAGCT-
TCTTCTGG-TAMRA. Data are expressed as the cycle threshold
(Ct, the cycle at which mRNA is initially detected).
Cell Adhesion, Migration, and Mobilization Assays. Day 12 colony-
forming units-spleen (CFU-S12) and in vitro colony-forming
This paper was submitted directly (Track II) to the PNAS office.
Abbreviations: HSCyP cells, hematopoietic stemyprogenitor cells; HM, hematopoietic mi-
croenvironment; G-CSF, granulocyte colony-stimulating factor; CFU-S12, day 12 colony-
forming units-spleen; CFU-C, in vitro colony-forming units; FN, fibronectin; WT, wild type;
ADF, actin-depolymerizing factor; SDF-1, stromal-derived factor-1; PAK1, p21-activated
kinase-1; GST, glutathione-S-transferase.
‡F.-C.Y. and S.J.A. contributed equally to this work.
¶Present address: Walter and Eliza Hall Institute, Melbourne, Australia 3050.
**To whom reprint requests should be addressed at: Howard Hughes Medical Institute,
Indiana University School of Medicine, 1044 West Walnut Street, Room 402, Indianapolis,
IN 46202. E-mail: dwilliam@iupui.edu.
The publication costs of this article were defrayed in part by page charge payment. This
article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C.
§1734 solely to indicate this fact.
5614–5618 u PNAS u May 8, 2001 u vol. 98 u no. 10 www.pnas.orgycgiydoiy10.1073ypnas.101546898
units (CFU-C) in peripheral blood [assays were as described (3)]
were assayed 5 days after the beginning of treatment with 250
mgykg human G-CSF given at 12-h intervals. Animals were bled
12 h after the last injection and either plated (CFU-C) or injected
into secondary recipients (CFU-S12). CFU-S12 in peripheral
blood after treatment with G-CSF alone or with both G-CSF and
anti-a4b1 antibody [purified anti-mouse CD49e antibody (R1–2;
PharMingen) at 2 mgykgyday for 3 days] were counted as
described (15). Animals were killed the day after the third dose.
Adhesion of Lin2c-Kit1Sca-11 bone marrow cells was as-
sayed as described (4). Briefly, nontissue culture plates were
coated with fibronectin (FN) fragments (H-296, which contains
the VLA-4 binding site; CH-271, which contains the VLA-5
binding site) at 8 mgycm2 or BSA (as control) overnight at 4°C.
The plates were subsequently blocked with 2% BSA for 30 min
at room temperature. A total of 1 3 105 wild-type (WT) or
Rac22y2 cells in RPMI 1640 medium containing 10% FBS
were then allowed to adhere to the coated plates for 1 h at 37°C.
After incubation, we collected nonadherent cells by carefully
rinsing the plates multiple times with medium. Adherent cells are
harvested by vigorously rinsing the plates with PBS. The cells are
counted with a hemocytometer and replated in CFU assay.
Migration assays were performed in transwells as described
(16). All assays were performed in triplicate. Briefly, 100 ml of
serum-free chemotaxis buffer (RPMI 1640 medium, 0.5% crys-
tallized deionized BSA) (Calbiochem) containing 2 3 105
Lin2c-Kit1Sca-11 cells was added to the upper chamber of a
5-mm-pore filter (Transwell, 24-well cell clusters; Costar), and
0.6 ml of serum-free chemotaxis buffer with various concentra-
tions of stromal-derived factor-1 (SDF-1) was added to the lower
chamber. After 4 h of incubation at 37°C in 5% CO2, the upper
chamber was carefully removed, and the cells in the bottom
chamber were resuspended and divided into aliquots for cell
enumeration and CFU assay.
Motility of Lin2c-Kit1Sca-11 cells was also directly observed
by time lapse imaging of cells exposed to a gradient of 0–100 nM
SDF-1 in a Dunn chemotaxis chamber (Weber Scientific, Surrey,
U.K.) (17) as described (10). Lin2c-Kit1Sca-11 cells (2–5 3 104
cells in 10 ml of Hanks’ balanced salt solution) were applied to
glass coverslips coated with fibronectin fragment CH-296 as
described above and allowed to adhere for 10 min at 37°C. The
coverslips were mounted on the Dunn chamber, the inner well
of which was filled with Hanks’ balanced salt solution, and the
outer well was filled with Hanks’ balanced salt solutionySDF-1.
The chamber was sealed and mounted on the stage of a Nikon
Diaphot 300 inverted microscope equipped with differential
interference contrast optics. The chamber temperature was
maintained at 37°C with a stage heater (Instec Instruments,
Boulder, CO). The chamber was allowed to equilibrate for 20
min to allow a stable gradient to form. Images were recorded
digitally at 15-s intervals with a Spot RT cooled charge-coupled
device camera. Images were collected for 1 h. The microscope
was calibrated with the use of the grating of a hemocytometer.
Tracks of the centroids of individual cells were plotted over a
10-min segment of the recording with the use of METAMORPH
software (Universal Imaging, Brandywine, PA). The scalar
speed of movement was calculated from the total distance
traveled over 10 min. In four experiments .250 cells were
analyzed for each genotype. Cells moving at .2 mmymin were
considered to show a motile response. The frequency of WT
HSCyP cells moving in this assay was much lower than that
observed for WT bone marrow neutrophils (35%; see ref. 10) but
was comparable to our observations of mast cells with this assay
(S.J.A., F.-C.Y., and D.A.W., unpublished observations).
Glutathione S-transferase-p21-Activated Kinase-1 (GST-PAK1) p21-
Binding Domain Pull-Down Assay. PAK1 p21-binding domain
(PBD)-GST was expressed in Escherichia coli strain BL21 and
purified as described (18). Purified Lin2c-Kit1 bone marrow
cells (1 3 106 cells per lane) were treated with 100 ngyml of
SDF-1 for 5 min, mixed with cold PBS, and pelleted. The pellets
were resuspended in PBS, lysed, and clarified as described. For
in vitro guanine nucleotide binding, cell lysates were incubated
for 15 min at 30°C in the presence of 10 mM EDTA and 100 mM
GTPgS or 1 mM GDP for nucleotide exchange. The loading was
stopped by the addition of MgCl2 to 30 mM (19). The crude or
guanine nucleotide-loaded cell lysates (100 ml) were added to
200 ml of binding buffer (25 mM TriszHCl, pH 7.5y1 mM
DTTy30 mM MgCl2y40 mM NaCly0.5% Nonidet P-40) with 10
mg PAK1 PBD-GST recombinant protein and 5 ml of glutathi-
one-Sepharose 4B beads. The binding reaction was incubated for
1 h at 4°C and then washed two times with washing buffer (25
mM TriszHCl, pH 7.5y1 mM DTTy30 mM MgCl2y40 mM
NaCly0.5% Nonidet P-40) and three times with washing buffer
without detergent. The bead pellets were finally resuspended in
15 ml of Laemmli sample buffer. Each sample was analyzed on
12% SDSyPAGE and blotted by specific antibodies for Rac1
(1:2,000, clone 23A8; Upstate Biotechnology, Lake Placid, NY)
and Cdc42 (1:2,000, sc87G; Santa Cruz Biotechnology). The
secondary antibodies were horseradish peroxidase conjugated
(1:2,500; New England Biolabs). The immunoblots were de-
tected with a New England Biolabs Luminol kit and Kodak
Biomax film.
Retrovirus Transduction. Transduction of hematopoietic stemy
progenitor cells was performed by published methods (20), with
the use of vectors described (see references in specific figure
legends). Briefly, mice were injected with 5-fluorouracil (150
mgykg; Sigma). Bone marrow cells were harvested 48 h after
injection. Mononuclear cells obtained after density gradient
centrifugation were cultured for 2 days in the presence of stem
cell factor, G-CSF, and megakaryocyte growth and development
factor (all at 100 ngyml, all from Amgen Biologicals). The cells
were infected with MIEG3, MIEG-FR2, and T17NCdc42 virus
supernatant on FN CH-296-coated plates. On day 3 after
infection, the cells were stained with anti-mouse CD117 (c-Kit)
phycoerythrin (PharMingen), and the c-Kit1ygreen fluorescent
protein-positive cells were isolated by fluorescence-activated
cell sorter (FACStar Plus; Becton Dickinson) under sterile
conditions. Transfection efficiency ranged from 30% to 80%,
depending on the vector. The double-positive cells were used for
biological assays.
Results
Rac2-Deficient HSCyP Demonstrate Defective Cell Adhesion and En-
hanced Mobilization. HSCyP cells (c-kit1Sca-11Lin2, which
make up ,1% of the bone marrow cells but are highly enriched
in HSCyP) were isolated by immunodepletion and fluorescence-
activated cell sorting from Rac22y2 mice (10) and analyzed for
the expression of Rac2. As demonstrated by reverse transcrip-
tion–PCR, c-kit1Sca-11Lin2 cells from WT mice express Rac2
mRNA, whereas the 298-bp Rac2 amplicon (11) is absent from
cells derived from Rac22y2 mice (Fig. 1A). Compared with WT
littermates, the blood of Rac22y2 mice contained significantly
higher numbers of these cells, measured either by CFU-C assays
or CFU-S12 assays (Fig. 1B). The increased number of HSCyP in
the circulation contrasts with the bone marrow contents of
HSCyP in Rac22y2 mice, which are identical to WT mice (data
not shown). A slight but insignificant increase in the numbers of
CFU-S12 was seen in the spleen at baseline (Fig. 1C). Egress of
HSCyP from the bone marrow into the blood can be induced by
the administration of G-CSF in a process known as mobilization.
Rac22y2 mice injected with G-CSF mobilized HSCyP into the
blood in 3- to 4-fold greater numbers than similarly treated WT
mice (Fig. 1B). The number of CFU-S12 was also significantly
increased in the spleen of Rac22y2 mice compared with WT,
Yang et al. PNAS u May 8, 2001 u vol. 98 u no. 10 u 5615
CE
LL
BI
O
LO
G
Y
but this increase was to a lesser extent than in peripheral blood
(Fig. 1C). Because Papayannopoulou et al. (21) have also
reported differences in the in vivo effects of antibody to integrin
a4b1 on splenic vs. bone marrow content of progenitors, these
data suggest that a different mechanism may mediate the
adhesion or entrapment of primitive cells in the spleen compared
with the bone marrow. Real-time PCR confirmed equivalent
expression of the receptor for G-CSF, for which no antibody
reagents are available to assess protein expression (Ct 5 23.2 vs.
23.4, WT vs. Rac22y2, mean of two determinations).
Integrin receptors have been implicated in the adhesion of
HSC to proteins in the HM (reviewed in ref. 2). Because
migration out of the marrow could reflect diminished adhesion
of the cells in the HM, and because the b1 integrins have been
demonstrated by our laboratory (3, 4) and by other investigators
(5, 6, 22) to mediate adhesion of these cells, further analysis of
the expression and function of integrins was carried out. Ex-
pression of the integrins a4b1 (Fig. 2A) and a5b1 (not shown),
as determined by flow cytometric analysis, was not affected by
the lack of Rac2 expression, whereas adhesion of HSCyP cells
derived from Rac22y2 mice to the recombinant FN peptide
H296 (4), containing specific ligand sequences, CS1, of the
integrin a4b1 was significantly reduced compared with WT cells
(Fig. 2B). The defect in adhesion via a4b1 appears to be a
specific consequence of Rac2 deficiency, inasmuch as adhesion
of Rac22y2 cells is restored to normal after expression of the
Rac2 cDNA via the retrovirus vector MIEG3-FR2 (13) (WT,
50.0 6 2% adhesion; Rac22y2, 17.6 6 4%; Rac22y2 trans-
duced with MIEG3-FR2, 46.0 6 7%; P , 0.01, WT vs.
Rac22y2; P . 0.05, Rac2-transduced vs. WT). Adhesion via
another b1 integrin expressed in HSCyP cells, a5b1, to an
Arg-Gly-Asp-Ser (RGDS) sequence of FN contained in the
recombinant peptide CH-271 (4) was lower but not significantly
different from WT (Fig. 2B, P . 0.05).
The defect in adhesion via a4b1 demonstrated in vitro likely
explains the increased mobilization seen in vivo, because mobi-
lization into the blood or spleen by the administration of anti-a4
integrin antibody results in equivalent numbers of CFU-S12 in
the blood of WT mice as observed at baseline in Rac22y2 mice.
Furthermore, no additional increase in the number of circulating
CFU-S12 is seen in Rac22y2 mice after treatment with anti-a4
antibody alone (Fig. 2C), and no augmentation of mobilization
is seen in Rac22y2 mice with the combined treatment of G-CSF
and anti-a4 antibody, as expected in normal mice (15) and seen
here in WT mice (Fig. 2C).
Rac2-Deficient HSCyP Cells Are Hypermotile in Vitro. Chemokine-
stimulated migration of primitive hematopoietic cells has also
been postulated to be a mechanism of mobilization of hemato-
poietic progenitor cells (16). Thus, to further explore the rela-
tionship between Rac2 deficiency and increased mobilization in
vivo of primitive blood cells, purified HSCyP cells were analyzed
in vitro for migration in response to SDF-1, a potent chemokine
chemoattractant for primitive hematopoietic cells (16, 23). We
initially considered enhanced responsiveness to chemokines as
an unlikely explanation for the excess of circulating HSCyP, as
deficiency of Rac2 function results in decreased migration and
F-actin generation in multiple differentiated blood cell types
(10–13, 18).
Unexpectedly, despite equivalent expression of the SDF-1
receptor, CXCR4 (Ct 5 26.6 vs. 27.5, Rac2WT vs. Rac22y2,
mean of three determinations) as measured by real-time PCR,
SDF-1-stimulated primitive cells (c-kit1Sca-11Lin2) from
Rac22y2 mice demonstrated increased migration in transwell
chambers (16) across multiple concentrations (Fig. 3A). This
increase in cells in the bottom chamber of the transwell was also
noted when transwell membranes were coated with FN H296,
but not on membranes coated with FN CH296, which contains
ligands for both a4b1 and a5b1. In addition, antibody to a4b1
has significantly more effect in diminishing the number of WT
vs. Rac22y2 cells in lower chambers coated with FN H296 and
in uncoated wells (data not shown), which is similar to the effect
seen in in vivo mobilization studies. The difference in apparent
migration of FN CH296 in transwells vs. Dunn chambers may
relate to the ability of Rac22y2 cells to maintain near-normal
adhesion via a5b1 (see Fig. 2B). When the undersides of filters
from transwells coated with FN CH296 were examined, nearly
equivalent numbers of primitive cells were present in Rac22y2
vs. WT chambers. Thus, with adhesion via a5b1 still effective,
fewer cells were detected in the bottom chamber, reducing the
apparent migration. Because of the nature of the Dunn analysis,
adhesion via a5b1 would still allow the hypermotility phenotype
to be seen. Both increased velocity of migration (Fig. 3B) and
increased frequency of responding cells (6.7 6 3.1% vs. 1.1 6
2.2%, Rac22y2 vs. WT, P 5 0.01) were further documented in
Rac2-deficient cells by analysis with time-lapsed video micros-
copy in Dunn chambers.
Fig. 1. Enhanced mobilization of hematopoietic stem and progenitor cells
from the bone marrow of Rac22y2 mice. (A) Reverse transcription–PCR
analysis for expression of Rac2 mRNA in c-kit1Sca-11Lin2 cells from WT and
Rac22y2 mice. Lane 1: WT neutrophils as a positive control. Lane 2: WT HSCyP
cells. Lane 3: Rac22y2 HSCyP cells. (B) Enumeration of day CFU-S12 and CFU-C
in peripheral blood at baseline or after treatment with 250 mgykg human
G-CSF. Closed bars, baseline; open bars, G-CSF-treated mice. Mean 6 SD, *, P ,
0.01. CFU colonies contained mixed myeloid, pure myeloid, or megakaryocytic
lineages. (C) Enumeration of CFU-S12 and CFU-C in spleen after treatment
with G-CSF. Closed bars, baseline; open bars, G-CSF-treated mice. Mean 6 SD;
*, P , 0.05.
Fig. 2. Effect of Rac2 deficiency on integrin-mediated cell adhesion. (A)
Expression of integrin a4b1 (VLA-4) analyzed by flow, one representative
experiment of three with identical results, with biotin-conjugated anti-a4
mAb. The solid curve represents expression of a4b1 as detected by mAb; open
tracing represents an isotype control. (B) Adhesion of HSCyP cells to FN H296,
containing the heparin binding site and the CS-1 binding site for a4b1, or to
FN CH271 containing the heparin binding site and the RGDS binding site for
a5b1. Closed bars, WT mice; open bars, Rac22y2 mice. Mean 6 SD, *, P , 0.01.
(C) Enumeration of CFU-S12 in peripheral blood after treatment with G-CSF
alone or with both G-CSF and anti-a4b1 antibody. Closed bars, WT mice; open
bars, Rac22y2 mice. Mean 6 SD; *, P , 0.01.
5616 u www.pnas.orgycgiydoiy10.1073ypnas.101546898 Yang et al.
Compensatory Increases in Cdc42 and Rac1 Lead to Increased Cell
Migration of HSCyP Cells. Because previous evidence has suggested
that blocking one Rho GTPase protein pathway might result in
modulation of other GTPases, affecting cell migration and
morphology (24, 25), scanning electron micrographs of purified
HSCyP cells were obtained before and after stimulation with
SDF-1. Scanning electron micrographs of unstimulated cells
showed only subtle differences between genotypes. However,
after SDF-1 stimulation many Rac22y2 HSCyP cells demon-
strated more uniformly long filopodia (Fig. 3 C vs. D). Confocal
images of stimulated cells (Fig. 3 C and D, Inset) revealed
pronounced F-actin staining and spike-like projections in
Rac22y2 cells. Whereas the content of F-actin seen at baseline
was slightly lower in Rac2-deficient cells as measured by quan-
titative flow analysis (10), there was a significantly larger in-
crease in F-actin content demonstrated in HSCyP from
Rac22y2 mice after SDF exposure (Fig. 3E). In fibroblasts,
formation of filopodia is commonly associated with activation of
the Rho GTPase Cdc42 (26), and with the use of constitutively
active mutants, the activity of this Rho GTPase has been shown
to positively regulate the activity of Rac (26). Cdc42 has also
been implicated in macrophage movement (27). We therefore
examined HSCyP cells from Rac22y2 mice for the expression
and activity of Cdc42 and for Rac1, the ubiquitously expressed
GTPase protein highly homologous to Rac2. Despite compara-
ble levels of the two proteins as measured by immunoblot (data
not shown), activated (GTP-bound) Cdc42 measured by GST-
PAK1 p21-binding domain pull-down (18) was increased by 3- to
20-fold in Rac22y2 cells after exposure to SDF-1, compared
with WT cells (Fig. 4A). Interestingly, activated Rac1 was also
increased by about 3-fold (Fig. 4A). In separate experiments, an
increase in the percentage of GTP-bound (active) Cdc42 and
Rac1 was also demonstrated. Active Cdc42 (GTP-bound) as a
percentage of total Cdc42 increased after SDF-1 stimulation
from 0.12% to 0.74% (6-fold) in WT cells, but from 3.12% to
49.26% (16-fold) in Rac22y2 cells, showing both some increase
in baseline active Cdc42 and a significant apparent compensa-
tory response of Cdc42 activation in the absence of Rac2. Active
(GTP-bound) Rac1 increased after stimulation from 4.4% to
28.6% (6.5-fold) in WT cells, but from 21.4% to 49.3% (2.3-fold)
in Rac22y2 cells.
This increased activity appears to be important in the observed
motility of Rac22y2 HSCyP cells, inasmuch as actin-depolymer-
izing factor (ADF)ycofilin phosphorylation, which reflects LIM
kinase activities and is a known downstream target of Cdc42 and
Rac (28), is significantly elevated after stimulation in Rac22y2
cells (Fig. 4B), whereas expression of the dominant negative Cdc42
bearing Thr3Asp at position 17 is associated with reversal of the
enhanced filopodia in Rac22y2 cells (Fig. 4C; MIEG3 represents
empty vector, Cdc42 represents N17Cdc42) and a reversal of the
increased migration (Fig. 4D) after SDF-1 stimulation, but has no
effect on the adhesion of Rac22y2 cells (data not shown). At
baseline, the phosphorylation of ADFycofilin is also increased in
Rac22y2 cells compared with WT cells (data not shown). Because
ADFycofilin phosphorylation inhibits the F-actin depolymerization
activity of cofilin proteins (28), increased Lim kinase activity and
increased phosphorylation of ADFycofilin could explain the in-
creased F-actin content in Rac22y2 cells.
Discussion
The consequence of Rac2 deficiency in HSCyprogenitor cells
includes decreased integrin-mediated adhesion and increased
Fig. 3. Measurement of in vitro migration and F-actin polymerization after
stimulation with the chemokine SDF-1. (A) Migration of c-kit1Sca-11Lin2 cells in
transwell chamber assay in response to SDF-1. E, Rac22y2 cells; F, WT cells.
Mean 6 SD, *, P , 0.01. (B) Frequency of cells moving as measured with time-
lapsed video microscopy in Dunn chambers. Closed bars, WT cells; open bars,
Rac22y2 cells. Data show frequency of cells moving at specified speeds and are
from one of three representative experiments. See Materials and Methods for
detailsof theassay. (CandD) Scanningelectronmicrographsandconfocal images
of cells fixed 10 s after stimulation with 1 mM SDF-1. There was increased length
of filopodia on (C) Rac22y2 cells compared with (D) WT stimulated with SDF-1.
(Insets) Confocal microscopy performed after staining with 0.1 mgyml rhodamine
phalloidin shows increased F-actin staining and filopodia in SDF-1-stimulated
Rac22y2 cells compared with WT. Cells were imaged with a Zeiss LSM 510 Laser
scanning confocal microscope at 3100. (E) Increase in F-actin content after
stimulation with SDF-1 analyzed by phalloidin staining and flow cytometry (10).
E, Rac22y2 cells; F, WT cells. One of three experiments showing similar results
is presented.
Fig. 4. Biochemical analysis of activation of Cdc42 and Rac1 and downstream
targets in hematopoietic stem and progenitor cells from Rac22y2 mice. (A)
Increased Cdc42 and Rac1 activation in Rac22y2 cells as analyzed by GST-PAK1
p21-binding domain pull-down (18), one of three experiments showing similar
results. (Upper) Densitometric determination of immunoblot bands shown be-
low. Closed bars, WT cells; open bars, Rac22y2 cells. (B) Increased inhibitory
phosphorylation of ADFycofilin as measured by immunoblot with phosphoryla-
tion-specific polyclonal antibody (anti-pADF, 1:100 dilution) (34). Closed bars, WT
cells; open bars, Rac22y2 cells. Data are mean 6 SD of densitometric determi-
nation of four independent experiments. *, P , 0.01. (C) Reversal of filopodia as
analyzed by confocal microscopy performed after staining with 0.1 mgyml rho-
daminephalloidinafterexpressionofdominantnegativeCdc42(Lower)orempty
vector MIEG3 (Upper). The T17NCdc42 mutant and WT Rac2 (not shown) were
introduced into the cells via the retrovirus vectors pMX-IRES (35, 36) and MIEG3-
FR2, respectively, with published methods (20). (D) Reversal of increased migra-
tion of Rac22y2 vs. Rac21y1 HSCyP cells after stimulation with SDF-1 analyzed
in a transwell chamber assay after expression of empty vector (MIEG3), WT Rac2
(FR2), or N17Cdc42. The data are expressed as percentage change vs. Rac2WT
(1y1) cells (*, P 5 0.02, n 5 3). (Inset) Migration data expressed as percentage of
cells migrating, showing increased migration of Rac22y2 cells (open bars) ex-
pressing empty vector (MIEG3), which is reduced by expression of Rac2 (FR2).
Expression of N17Cdc42 further reduces migration, but to a larger degree in
Rac22y2 cells.
Yang et al. PNAS u May 8, 2001 u vol. 98 u no. 10 u 5617
CE
LL
BI
O
LO
G
Y
HSCyP cells in the blood, with enhanced migration of these cells in
response to stimulation. Increased numbers of HSCyprogenitor
cells in the blood are not likely a consequence of increased numbers
of these cells, because the number of CFUs is equivalent in the bone
marrow of Rac22y2 and WT mice. These adhesion and migration
abnormalities are associated with increased Cdc42 and Rac1 acti-
vation, actin polymerization, and increased mobilization of HSCy
progenitor cells out of the marrow cavity. The adhesion defects are
directly related to Rac2 deficiency and cannot be compensated for
by increased Rac1 activity. In contrast, the increased migration of
Rac22y2 HSCyP cells reflects Cdc42 activation and implies that
normal migration requires the coordinated regulation of Rac and
Cdc42 GTPase activities. Data presented here also suggest a
feedback mechanism leading to increased activation of Cdc42 and
Rac1 in the absence of Rac2. Compensatory changes in GTPase
activity have been noted in cell lines after overexpression of
activated or dominant negative mutants of Rac, Cdc42, or Rho (24,
25), but have not been demonstrated in primary cells under
physiological conditions. More recent experiments have also dem-
onstrated induction of Rac1 protein during ex vivo expansion of
Rac22y2 primitive hematopoietic cells (37). These data substan-
tiate the assumption that in primary cells there is considerable
cross-talk between GTPases (9).
Because increased activation of other GTPases, in particular of
Rac1, is ineffective in reversing the adhesion defects consequent to
Rac2 deficiency, these data also imply that Rac2 plays a critical and
specific role in the adhesion of these primitive cells. The basis for
this potential specificity of Rac function is unknown, but subcellular
localization may be important. Both Rac1 and Rac2 contain
conserved CAAX motifs in the C-terminal tail, which mediate
attachment of farnesyl moieties and therefore may mediate pro-
teinyprotein or membrane targeting (29). Differences in Rac1 and
Rac2 sequences reside primarily in the area immediately preceding
this motif, where Rac1 contains a stretch of basic amino acids,
whereas nonbasic residues in the Rac2 protein interrupt this region.
Signaling proteins with polybasic regions may colocalize within
regions of the membranes enriched in acidic phospholipids, and
thus these sequences may enhance membrane targeting or colo-
calization of relevant interacting proteins (29, 30). In addition,
polylysines in this region may be involved in specifying effector
recognition, as recently shown for Cdc42 interaction with an
effector, the g subunit of coatomer complex (31). In addition, this
region of Rac2 may be involved in homodimer formation (32).
Additional studies have demonstrated that this motif, TRQQKRP,
is essential for the biological function and intracellular localization
of Rac2 (W. Tao, J. R. Bailey, S.J.A., B. Connors, A. Evan, and
D.A.W., unpublished observations).
Finally, as the increase in cell migration seen in Rac2-deficient
HSCyP is in absolute contrast to the marked diminution in move-
ment observed in their mature cell progeny, the consequences of
Rac activation clearly depend on cell type, maturation stage, and,
potentially, activation signals. These data suggest that receptor
pathways, lineage-specific signals (either guanine exchange factors
or downstream effectors), andyor the levels of other GTPases differ
in progeny of HSCyP cells. In this regard, because adhesion of
HSCyP ex vivo appears to be important in stem cell survival and
function and because Rac2-deficient mast cells show both de-
creased adhesion to FN and increased apoptosis (11), an intriguing
possibility yet to be explored is that Rac-dependent signaling,
specifically via kinase cascades (33), also links adhesion and growth
factor stimulation to the survival of HSCyP.
We thank Drs. Willem Fibbe, Stuart Orkin, and Anne Ridley and
members of the Wells Center for Pediatric Research for reviewing the
initial version of the manuscript. We also thank Eva Meunier and Sharon
Smoot for assistance in manuscript preparation. We thank Dr. James
Bamburg, Colorado State University, for the antibody to ADFycofilin,
and Robert Breese for maintaining Rac2 murine stocks. We are grateful
to Drs. Andrew Evan and Brett Connors for assistance with scanning
electron microscopy and for use of facilities in the Department of
Anatomy, Dr. Jun Chen for assistance in real-time PCR analysis, and
Chad Harris for technical assistance. The Wells Center for Pediatric
Research is a Core Centers of Excellence in Molecular Hematology (P30
DK49218). F.-C.Y., A.W.R., and Y.G. are Research Associates, and
D.A.W. is an Associate Investigator with the Howard Hughes Medical
Institute. A.W.R. was also supported by a Neil Hamilton Fairley
Fellowship (977211) from the National Health and Medical Research
Council of Australia.
1. Greenberger, J. S. (1991) Crit. Rev. Oncol.yHematol. 11, 65–84.
2. Papayannopoulou, T. & Craddock, C. (1997) Acta Haematol. 97, 97–104.
3. Williams, D. A., Rios, M., Stephens, C. & Patel, V. (1991) Nature (London) 352,
438–441.
4. van der Loo, J. C., Xiao, X., McMillin, D., Hashino, K., Kato, I. & Williams,
D. A. (1998) J. Clin. Invest. 102, 1051–1061.
5. Verfaillie, C. M., McCarthy, J. B. & McGlave, P. B. (1991) J. Exp. Med. 174,
693–703.
6. Papayannopoulou, T. & Nakamoto, B. (1993) Proc. Natl. Acad. Sci. USA 90,
9374–9378.
7. Hall, A. (1998) Science 279, 509–514.
8. Vojtek, A. B. & Der, C. J. (1998) J. Biol. Chem. 273, 19925–19928.
9. Bar-Sagi, D. & Hall, A. (2000) Cell 103, 227–238.
10. Roberts, A. W., Kim, C., Zhen, L., Lowe, J. B., Kapur, R., Petryniak, B.,
Spaetti, A., Pollock, J. D., Borneo, J. B., Bradford, G. B., et al. (1999) Immunity
10, 183–196.
11. Yang, F. C., Kapur, R., King, A. J., Tao, W., Kim, C., Borneo, J., Breese, R.,
Marshall, M., Dinauer, M. C. & Williams, D. A. (2000) Immunity 12, 557–568.
12. Ambruso, D. R., Knall, C., Abell, A. N., Panepinto, J., Kurkchubasche, A.,
Thurman, G., Gonzalez-Aller, C., Hiester, A., deBoer, M., Harbeck, R. J., et
al. (2000) Proc. Natl. Acad. Sci. USA 97, 4654–4659. (First published April 11,
2000; 10.1073ypnas.080074897)
13. Williams, D. A., Tao, W., Yang, F. C., Kim, C., Gu, Y., Mansfield, P., Levine,
J. E., Petryniak, B., Derrow, C. W., Harris, C., et al. (2000) Blood 96, 1646–1654.
14. Heid, C. A., Stevens, J., Livak, K. J. & Williams, P. M. (1996) Genome Res. 6,
986–994.
15. Craddock, C. F., Nakamoto, B., Andrews, R. G., Priestley, G. V. & Papayan-
nopoulou, T. (1997) Blood 90, 4779–4788.
16. Aiuti, A., Webb, I. J., Bleul, C., Springer, T. & Gutierrez-Ramos, J. C. (1997)
J Exp. Med. 185, 111–120.
17. Zicha, D., Dunn, G. A. & Brown, A. F. (1991) J. Cell Sci. 99, 769–775.
18. Benard, V., Bohl, B. P. & Bokoch, G. M. (1999) J. Biol. Chem. 274,
13198–13204.
19. Knaus, U. G., Heyworth, P. G., Kinsella, B. T., Curnutte, J. T. & Bokoch, G. M.
(1992) J. Biol. Chem. 267, 23575–23582.
20. Hanenberg, H., Hashino, K., Konishi, H., Hock, R. A., Kato, I. & Williams,
D. A. (1997) Hum. Gene Ther. 8, 2193–2206.
21. Papayannopoulou, T., Craddock, C., Nakamoto, B., Priestley, G. V. & Wolf,
N. S. (1995) Proc. Natl. Acad. Sci. USA 92, 9647–9651.
22. Hirsch, E., Iglesias, A., Potocnik, A. J., Hartmann, U. & Fassler, R. (1996)
Nature (London) 380, 171–175.
23. Peled, A., Petit, I., Kollet, O., Magid, M., Ponomaryov, T., Byk, T., Nagler, A.,
Ben-Hur, H., Many, A., Shultz, L., et al. (1999) Science 283, 845–848.
24. Moorman, J. P., Luu, D., Wickham, J., Bobak, D. A. & Hahn, C. S. (1999)
Oncogene 18, 47–57.
25. Sander, E. E., ten Klooster, J. P., van Delft, S., van der Kammen, R. A. &
Collard, J. G. (1999) J. Cell Biol. 147, 1009–1022.
26. Nobes, C. D. & Hall, A. (1995) Cell 81, 53–62.
27. Allen, W. E., Zicha, D., Ridley, A. J. & Jones, G. E. (1998) J. Cell Biol. 141,
1147–1157.
28. Sumi, T., Matsumoto, K., Takai, Y. & Nakamura, T. (1999) J. Cell Biol. 147,
1519–1532.
29. Resh, M. D. (1996) Cell Signal. 8, 403–412.
30. Choy, E., Chiu, V. K., Silletti, J., Feoktistov, M., Morimoto, T., Michaelson, D.,
Ivanov, I. E. & Philips, M. R. (1999) Cell 98, 69–80.
31. Wu, W. J., Erickson, J. W., Lin, R. & Cerione, R. A. (2000) Nature (London)
405, 800–804.
32. Zhang, B. & Zheng, Y. (1998) J. Biol. Chem. 273, 25728–25733.
33. Vojtek, A. B. & Cooper, J. A. (1995) Cell 82, 527–529.
34. Meberg, P. J., Ono, S., Minamide, L. S., Takahashi, M. & Bamburg, J. R. (1998)
Cell Motil. Cytoskeleton 39, 172–190.
35. Kinsella, T. M. & Nolan, G. P. (1996) Hum. Gene Ther. 7, 1405–1413.
36. Liliental, J., Moon, S. Y., Lesche, R., Mamillapalli, R., Li, D., Zheng, Y., Sun,
H. & Wu, H. (2000) Curr. Biol. 10, 401–404.
37. Gu, Y., Jia, B., Yang, F.-C., D’Sovzza, M., Harris, C. E., Derrow, C. W., Zheng,
Y. & Williams, D. A. (2001) J. Biol. Chem. 276, in press.
5618 u www.pnas.orgycgiydoiy10.1073ypnas.101546898 Yang et al.